Review



addgene plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/bio_rxiv__64898__2026__03__24__713622-222-20-20
    Average 96 stars, based on 204 article reviews
    addgene plasmid - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Synchronization of the segmentation clock using synthetic cell-cell signaling.
    Article Snippet: .. GENES & DEVELOPMENT 9 For genome editing of mouse embryonic stem cells (mESCs), we used a high-fidelity CRISPR–Cas9 nuclease: eSpCas9(1.1) (a generous gift from Feng Zhang, Addgene 71814) (Slaymaker et al. 2016). ..

    Article Title: Synchronization of the segmentation clock using synthetic cell–cell signaling
    Article Snippet: .. For genome editing of mouse embryonic stem cells (mESCs), we used a high-fidelity CRISPR–Cas9 nuclease: eSpCas9(1.1) (a generous gift from Feng Zhang, Addgene 71814) ( ). ..

    Article Title: Transcription factor-mediated germ cell induction in rats reveals ETV4 cooperates with germline specifiers
    Article Snippet: All rat cDNAs were amplified by PCR using PrimeSTAR MAX DNA polymerase (Takara Bio, Shiga, Japan) or KOD One DNA polymerase (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. .. For generating Tbxt KO rESCs, gRNA sequence described in A is subcloned into eSpCas9(1.1) (Addgene #71814) CRISPR/Cas9 vector. ..

    Plasmid Preparation:

    Article Title: Modeling the t(2;5) Translocation of Anaplastic Large Cell Lymphoma Using CRISPR-Mediated Chromosomal Engineering
    Article Snippet: The MSCV_Cas9_Puro plasmid was a gift from Christopher Vakoc (Addgene plasmid # 65,655) [ ]. .. The eSpCas9 (1.1) (enhanced Streptococcus pyogenes Cas9) plasmid was a gift from Feng Zhang (Addgene plasmid # 71,814) [ ]. .. The pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid was a gift from Feng Zhang (Addgene plasmid # 42,230) [ ].

    Article Title: mTORC2-mediated cell-cell interactions promote BMP4-induced WNT activation and mesoderm differentiation
    Article Snippet: .. Targeting vector eSpCas9(1.1)-2A-Puro was constructed by replacing the Cas9 in pSpCas9(BB)-2A-Puro (PX459) with Cas9(1.1) from eSpCas9(1.1) (Addgene) ( ; ). .. Two sgRNAs (GGCCACAGTGAAGAAAAACTGGG and AGACTCCAGTATTCTCCAGA-AGG) were selected for co-transfection into H1 hESCs using the Neon Transfection system (Thermo Fisher Scientific) following the manufacturer’s instruction ( A and S1B).

    Article Title: mTORC2-mediated cell-cell interactions promote BMP4-induced WNT activation and mesoderm differentiation.
    Article Snippet: .. Targeting vector eSpCas9(1.1)-2A-Puro was constructed by replacing the Cas9 in pSpCas9(BB)-2A-Puro (PX459) with Cas9(1.1) from eSpCas9(1.1) (Addgene) (Ran et al., 2013; Slaymaker et al., 2016). .. Two sgRNAs (GGCCACAGTGAAG AAAAACTGGG and AGACTCCAGTATTCTCCAGA-AGG) were selected for co-transfection into H1 hESCs using the Neon Transfection system (Thermo Fisher Scientific) following the manufacturer’s instruction (Figures S1A and S1B).

    Clone Assay:

    Article Title: Deletion of AC8 in glioma cells elevates oxidative phosphorylation by system-wide remodeling of the mitochondrial proteome.
    Article Snippet: Oligos were ordered from TAG Copenhagen (TAG Copenhagen A/S, Frederiksberg, Denmark). .. Guides 1–3 were cloned into both eSpCas9(1.1) (Addgene #71814) and pSpCas9(BB)-2 A-GFP (Addgene #48138) whilst guide 4 was cloned into eSpCas9(1.1), all using the restriction enzyme BbsI. ..

    other:

    Article Title: Treatment of Huntington’s disease with a pan-HTT-targeting CRISPR nuclease
    Article Snippet: SpCas9, SpCas9-NG and eSpCas9(1.1) were expressed from hCas9 (Addgene #41815), pX330-SpCas9-NG (Addgene #117919) and eSpCas9(1.1) (Addgene #71814), respectively.

    Sequencing:

    Article Title: Transcription factor-mediated germ cell induction in rats reveals ETV4 cooperates with germline specifiers
    Article Snippet: All rat cDNAs were amplified by PCR using PrimeSTAR MAX DNA polymerase (Takara Bio, Shiga, Japan) or KOD One DNA polymerase (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. .. For generating Tbxt KO rESCs, gRNA sequence described in A is subcloned into eSpCas9(1.1) (Addgene #71814) CRISPR/Cas9 vector. ..

    Construct:

    Article Title: mTORC2-mediated cell-cell interactions promote BMP4-induced WNT activation and mesoderm differentiation
    Article Snippet: .. Targeting vector eSpCas9(1.1)-2A-Puro was constructed by replacing the Cas9 in pSpCas9(BB)-2A-Puro (PX459) with Cas9(1.1) from eSpCas9(1.1) (Addgene) ( ; ). .. Two sgRNAs (GGCCACAGTGAAGAAAAACTGGG and AGACTCCAGTATTCTCCAGA-AGG) were selected for co-transfection into H1 hESCs using the Neon Transfection system (Thermo Fisher Scientific) following the manufacturer’s instruction ( A and S1B).

    Article Title: mTORC2-mediated cell-cell interactions promote BMP4-induced WNT activation and mesoderm differentiation.
    Article Snippet: .. Targeting vector eSpCas9(1.1)-2A-Puro was constructed by replacing the Cas9 in pSpCas9(BB)-2A-Puro (PX459) with Cas9(1.1) from eSpCas9(1.1) (Addgene) (Ran et al., 2013; Slaymaker et al., 2016). .. Two sgRNAs (GGCCACAGTGAAG AAAAACTGGG and AGACTCCAGTATTCTCCAGA-AGG) were selected for co-transfection into H1 hESCs using the Neon Transfection system (Thermo Fisher Scientific) following the manufacturer’s instruction (Figures S1A and S1B).



    Similar Products

    96
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/bio_rxiv__64898__2026__03__24__713622-222-20-20
    Average 96 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc crispr plasmid vector px459 v2 0 espcas9
    Crispr Plasmid Vector Px459 V2 0 Espcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/pm41762386-36-9-14
    Average 96 stars, based on 1 article reviews
    crispr plasmid vector px459 v2 0 espcas9 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc espcas9 1 1 plasmid
    Espcas9 1 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/pmc13045467-312-18-20
    Average 96 stars, based on 1 article reviews
    espcas9 1 1 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc espcas9 1 1 vector
    Espcas9 1 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/bio_rxiv__64898__2026__01__10__698822-38-9-11
    Average 96 stars, based on 1 article reviews
    espcas9 1 1 vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc espcas9 1 1
    Espcas9 1 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/pmc12758139-143-15-22
    Average 96 stars, based on 1 article reviews
    espcas9 1 1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested espcas9 plasmid
    Bbsi Digested Espcas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)+(Plasmid+%2371814)/bio_rxiv__64898__2025__12__30__686824-287-8-11
    Average 96 stars, based on 1 article reviews
    bbsi digested espcas9 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Addgene inc sgrna cas9 expression plasmids
    Sgrna Cas9 Expression Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/espcas9+1+1/eSpCas9(1%2E1)_No_FLAG_ATP1A1_G2_Dual_sgRNA+(Plasmid+%2386612)/pm41440036-363-5-9
    Average 94 stars, based on 1 article reviews
    sgrna cas9 expression plasmids - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results